Michael Cooley's Genetic Genealogy Blog GEN • GEN
6 November 2016

The following is the handout for a presentation I gave at the Society of Humboldt County Pioneers.

DNA Testing

Every genealogist runs into brick walls, that point when further genealogical research no longer yields results. DNA provides data that will often crumble walls. But rather than prove an ancestor, sometimes DNA will often disprove suspect connections. Myths are regularly broken.


1234567890123456789012345678901234567890123456789012345678901234567890123 CTCAAATTACATAGATTTTAGACTTACAAAAATTTTCTGGACAGATATGAAGAACATTATTAAACTAACAAAC AGCAATCCAGAACTTTTTTTGTTGTTGTTTTTGCTAAACGTATTTGTAGTTCTGTTAATTTCCTTACTGTAAT CTACCAACTTTATGTGATCTCTGTCTAAAAAGCAGAACTTTCTGGTCATTTCTAAAGAGCATAGAGATTTTAA GGAACATCAGCAATATTCAAATTTAAGAAAACTGATTATAACTTAGAAATTCTGAGGAAGAAGAGTAATGAGG GGTAACTTGTTCTAGCAGAAAATCAAGTATATTTTTATAACCACTTTAATTATTTTAACTACATACCTTCATC
Fig. 1. A short segment of my Y chromosome

In the above diagram, each letter represents a molecule abbreviated to A, C, G, or T. These four chemicals, strung together, make up the 3.1 billion pairs of bases in our genome.


THREE KINDS OF DNA

Chromosomes 1 through 22, known as autosomes, come in pairs, half from each parent. These pairs are shuffled in a process called recombination, and each child inherits a different recombination from each parent. For this reason, siblings (with the exception of twins) are unique to one another. They're not clones.

The Y chromosome (Y-DNA) and mitochondrial DNA (MT-DNA), however, do not come in pairs. Because the Y holds the male sex gene, only men have one. Since there's no complement contribution from the mother, there's no recombination. Therefore, a father hands down an exact copy of his Y to his sons—and so it goes, generation after generation. Two distantly-related men having a common ancestor who lived hundreds of years ago, can have remarkably similar DNA. A matching surname helps, but isn't always needed.

Mitochondrial DNA, which exists outside of the nucleus, is inherited from only the mother. That's because the energy requirements of a woman's egg dictates a rich supply of it. MT-DNA is simply a cell's battery. The sperm has only a tiny amount to power its tail, and that falls off as it enters the egg. Therefore, we get our MT-DNA from the mother's egg. The father makes no contribution.


FOUR KINDS OF MUTATIONS

Mutations are random and average about sixty per birth, and that's among 3.1 billion base pairs. They're rare.

A single-point mutation is simply an alteration to a single molecule (A, C, G, or T) anywhere in the DNA. For example, if a mutation occurred in the first line of the above code, we might have an A that changed to a C, often noted as A->C. For example, compare the first line at column 29 to this:


1234567890123456789012345678901234567890123456789012345678901234567890123 CTCAAATTACATAGATTTTAGACTTACACAAATTTTCTGGACAGATATGAAGAACATTATTAAACTAACAAAC
Fig. 2. Single point mutation

A new base inserted into the middle of a segment results is called an insertion. Here I've placed an insertion, another A, into that same spot. Now we have six A's rather than five, and everything else is shifted to the right:


1234567890123456789012345678901234567890123456789012345678901234567890123 CTCAAATTACATAGATTTTAGACTTACAAAAAATTTTCTGGACAGATATGAAGAACATTATTAAACTAACAAA
Fig. 3. Insertion

And here we have a deletion of the original A, resulting in only four A's and a shifting of the remaining bases to the left:


1234567890123456789012345678901234567890123456789012345678901234567890123 CTCAAATTACATAGATTTTAGACTTACAAAATTTTCTGGACAGATATGAAGAACATTATTAAACTAACAAACA
Fig. 4. Deletion

Repeats are an important issue in DNA analysis. These are regions in which identified strings of bases repeat X number of times. For example, in a region of my Y chromosome called DYS449, I have 34 repeats of TTTC. The technical term is Short Tandem Repeats or STRs, which are simply that: very short segments that repeat in tandem to one another.


CAAGCCTGTTCTATGAATATTTTCCCTTAACTTGTGTGATTTTTTGTTTAAAAAGTTCCCCCATGTTTTTTTCT
TGCTCTTTTTCTTTTCTCTCTTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC
TTTCTTTCTTTCTTTC
TCTCCTTTCTCTCTCTCCTCCTCTTTCTTTCCTTCTTTCTTTCTTTTCCTCTTTCCTT
CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCTCT
TTGTTTCTGTCTTACTCTTGTTGTCCAACCTAGAGTGCAATGGTGCAA
Fig. 5. 34 repeats of DYS449

TEST RESULTS

The value in testing is found in comparative analysis. Human DNA varies by less than 0.1 percent. But that's still a lot of data, and some products, such as FTDNA's Y-700, look at fifteen million positions.


Y-STR Results
89175132415101113121210131130
110624132415111113121210131130
238610132415111113121210131130
391325132415111113121210131130
160752132415111113121210131130
212010132415111113121210131130
128096132415111113121210131130
284548132415111113121210131130
520597132415111113121210131130
98452132415111113121210131130
N70352132415111113121210131130
N3690132415111113121210131130
102135132415111113121210131130
305732132415111113121210131130
57597132415111113121210131130
239164132415111113121213131130
323704132515111113121210131130
Fig. 6. Comparing Repeats (STRs)

The most popular male-only test looks at the repeats on the Y chromosome, as in the example for my DYS449 repeats. Generally, comparing surnames at 37 repeat regions — DYS449 just being one example — can show a tester which group of Smiths, or Bakers, or Fitzgeralds, he belongs to. For example, the example on the left is what my group of Cooleys looks like by comparing only the first twelve regions. Remember, these numbers represent the number of repeats of specific letters (a different sequence for each location). Each highlighted value represents a mismatch between testers. There should be no more than one mismatch out of twelve to suggest membership to a group.

Although this example looks great, a 12-marker test is too broad for making determinations. There can be literally dozens of surnames associated with such matches. We need more than twelve markers to make sensible determinations. Most project administrators will recommend that 37 markers be tested. Matches on both the surname and several markers are the makings of a surname DNA group.


Y-SNP Results

Repeats tend to mutate regularly within several generations and come in both insertions and deletions, which makes them somewhat unpredictable. They're fine for determining who belongs in what surname group, but single-point mutations are needed to make finer judgments. These are called Single Nucleotide Polymorphisms, or SNPs. Once these mutations occur, they tend to stick around for hundreds of generations, even hundreds of thousands of years, and pass from one generation to the next unaltered. Advanced SNP testing on one of the Cooley groups I work with, for example, is now broken into four collateral lineages, all having a common ancestor who lived in the 15th or 16th century. Everyone in the group has a SNP marker called A12020. But descendants of early colonial immigrant, Benjamin Cooley, have an added SNP mutation named A12022. That is, at the birth of a man around the year 1550, position 15070226 of the Y chromosome flipped from an A to a G. Those Cooleys not having it are not descended from Ben, despite what they may believe. But what we call the Goshen (New York) Cooleys have the addition of A20349, and descendants of Nehemiah Cooley may all have A14974 (that's yet to be determined with certainty). Because these Cooleys are well-documented in Hertfordshire, England, we have a chance of determining the relationship between the lineages.


Mitochondrial Results

SNP mutations are also used in testing mitochondrial DNA, that DNA inherited from the mother. MT-DNA has fewer than 17,000 bases, as opposed to about 57 million for the Y chromosome. Mutations, then, are rarer and occur more like once a millennium rather than once a century or so. These test results are arranged into clans. I'm of clan H, nicknamed Helen, as was my mother by virtue of the fact that my MT-DNA came from her. My dad was of clan V, nicknamed Velda, which is a rare European type. By definition, his mother was also of clan V. Although she died ten years before I was born, I do know that one very intimate detail about her.


Autosomal Results

Mutations are discovered by comparing test results to a pre-determined model, those bases that are presently believed to have been the ancestral values, the values present before the occurrence of mutations. We're now working with a model called hg38 — the 38th version of the human genome. But for determining the likely relationship between two people, autosomal tests look at the number of differences on chromosomes 1 through 22 between any two people.

 Segmts
father3586.9
sister2695.8
half-sister1897.1
second cousin235.8
third cousin98.5
Fig. 7. Autosomes

Once again, using myself as an example, I share 3586.9 segments of DNA with my dad, about half; 2695.8 segments with my sister; and 1897.1 segments with my half-sister. The segment count falls in line with our relationships.

Because autosomes go through recombination with each generation, the number of potential matches significantly declines. After five or six generations, shared segments become so tiny that two people match because of common descent (Identical By Descent) or simply by chance due to mutation (Identical By Sate). And a tester isn't going to match to two siblings in the same way because we each have differing combinations of our parents' DNA. That's especially true between you and any two cousins. Several third cousins descended from the same great-great-grandparents will not share the same matches. Although some overlap probably exists, it's possible that a legit third cousins will fall off the radar.

The Y chromosome and mitochondrial DNA are inherited in a specific pattern—father to son and mother to child. Two people who match on that basis will immediately understand why they match, even if the name of the common ancestor is unknown. It's simply the father's father's father, or the mother's mother's mother. For example, I share a huge portion of my Y-DNA with a man named Hackett. But our common ancestor lived about 800 years ago, likely in Scotland. This was before surnames, but we know we simply descend from differing lineages of sons.

This isn't true with autosomal matching. There is no specific pattern by which we inherit chromosomes 1 through 22, except that we get half from each parent. The only way to sort it out is to determine the degree of relationship with a test, contact the individual, then compare notes.

But autosomes do more than determine relationships, if not lineages. They can provide an ethnic breakdown. It was no surprise to me to discover that I'm 99.9 percent Western European, but there's more to it. Here's a small sampling of my own breakdown:


North Atlantic Baltic West
Medit.
Other
Fig. 8. Admixture

SUMMARY

Test Ancestors "tested for" Benefits
Y Chromosome
Short Tandem Repeats
(STRs)
"The Father Line"
(father's, father's, father, etc.)
Good for matching your Father Line with other testers with accuracy to about fifteen generations. Perfect for homing in on the American origins of your surname and placing your results in the proper group in a surname project.
Y Chromosome
Single Nucleotide
Polymorphisms (SNPs)
"The Father Line"
(father's, father's, father, etc.)
Deep Ancestry: Provides genetic information about the Father Line to thousands, even hundreds of thousands, of years. These mutations are highly stable.
Mitochondrial DNA "The Mother Line"
(mother's, mother's, mother, etc.)
Deep Ancestry: Provides genetic information about he Mother Line to thousands, even hundreds of thousands, of years.
Autosomal DNA A large sampling of many ancestors that are still represented in your DNA. (About 3% of your total genome is tested.) Helps in two ways:
1. Close genealogy to about five generations
2. Deep Ancestry: Broad sampling and general interpretation of ethnic origins.

TESTING COMPANIES


Test 23andMe FTDNA Ancestry.com
aDNA $199 $79 $99
aDNA Transfer No $69 No
X Included Included No
Y-STR No 12 markers: $59
37 markers: $169
67 markers: $268
111 markers: $359
No
Big Y No Ten million SNPS
$575
No
Y-SNP Included minimally Several products,
including Big Y, or $39/SNP
No
mtDNA Included minimally Included or $69 No
Full mtDNA No $199 No
Medical markers Yes No No
Matching Yes Yes Limited for non-member customers
Database Matches only Public Private

And autosomal test results can be transferred to gedmatch.com at no charge for further analysis.