Michael Cooley's Genetic Genealogy Blog GEN • GEN
6 November 2016

The following is the handout for a presentation I gave at the Society of Humboldt County Pioneers.

DNA Testing

Every genealogist runs into brickwalls, a time when further genealogical research no longer yields results. DNA provides data that often allows such walls to crumble. Rather than prove an ancestor, however, the results often disprove, once and for all, suspect connections. Myths are regularly broken.


1234567890123456789012345678901234567890123456789012345678901234567890123 CTCAAATTACATAGATTTTAGACTTACAAAAATTTTCTGGACAGATATGAAGAACATTATTAAACTAACAAAC AGCAATCCAGAACTTTTTTTGTTGTTGTTTTTGCTAAACGTATTTGTAGTTCTGTTAATTTCCTTACTGTAAT CTACCAACTTTATGTGATCTCTGTCTAAAAAGCAGAACTTTCTGGTCATTTCTAAAGAGCATAGAGATTTTAA GGAACATCAGCAATATTCAAATTTAAGAAAACTGATTATAACTTAGAAATTCTGAGGAAGAAGAGTAATGAGG GGTAACTTGTTCTAGCAGAAAATCAAGTATATTTTTATAACCACTTTAATTATTTTAACTACATACCTTCATC
Fig. 1. A short snippet of the Y chromosome

In the above diagram, each letter represents a molecule abbreviated to A, C, G, or T. Only these four chemical, strung together, make up the 3.1 billion pairs in our genome.


THREE KINDS OF DNA

Chromosomes 1 through 22, known as autosomes, come in pairs, half from each parent. These pairs are shuffled in a process called recombination. Each child inherits different a recombination from each parent, therefore siblings are unique to one another, not clones.

The Y chromosome (Y-DNA) and mitochondrial DNA (MT-DNA) do not come in pairs. The Y holds the male sex gene. Therefore, only men have one. Since there's no complement from the mother, there's no recombination. Therefore, a father hands down an exact copy to his sons—and so it goes, generation after generation. Two distantly related men having a common ancestor that lived hundreds of years ago, can have remarkably similar DNA. A matching surname is not needed.

Mitochondrial DNA, which exists outside of the nucleus, is inherited from only the mother. That's because a woman's egg is loaded with it. The sperm has only a tiny amount in its tail, which falls off as it enters the egg. Therefore, we get out MT-DNA from the mother's egg.


FOUR KINDS OF MUTATIONS

Mutations are random. There are an average of 60 per birth, and that's among 3.1 billion base pairs. They're rare.

A single point mutation is simply a change to a single molecule (A, C, G, or T) anywhere in the DNA. For example, if a mutation occurred in the first line of the above code, we could have an A changing to a C, often noted as A->C.


1234567890123456789012345678901234567890123456789012345678901234567890123 CTCAAATTACATAGATTTTAGACTTACACAAATTTTCTGGACAGATATGAAGAACATTATTAAACTAACAAAC
Fig. 2. Single point mutation

A new base inserted into the middle of a segment results in what we call an insertion. Here I've placed an insert, another A, into that same spot. We now have six A's rather than five Everything else is shifted to the right:


1234567890123456789012345678901234567890123456789012345678901234567890123 CTCAAATTACATAGATTTTAGACTTACAAAAAATTTTCTGGACAGATATGAAGAACATTATTAAACTAACAAA
Fig. 3. Insertion

And here we have a deletion of the original A, resulting in only four A's and a shifting of the remaining bases to the left:


1234567890123456789012345678901234567890123456789012345678901234567890123 CTCAAATTACATAGATTTTAGACTTACAAAATTTTCTGGACAGATATGAAGAACATTATTAAACTAACAAACA
Fig. 4. Deletion

And then there are regions in which strings of bases repeat X number of times. For example, in a region of my Y chromosome called DYS449, I have 34 repeats of TTTC.


CAAGCCTGTTCTATGAATATTTTCCCTTAACTTGTGTGATTTTTTGTTTAAAAAGTTCCCCCATGTTTTTTTCT
TGCTCTTTTTCTTTTCTCTCTTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC
TTTCTTTCTTTCTTTC
TCTCCTTTCTCTCTCTCCTCCTCTTTCTTTCCTTCTTTCTTTCTTTTCCTCTTTCCTT
CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCTCT
TTGTTTCTGTCTTACTCTTGTTGTCCAACCTAGAGTGCAATGGTGCAA
Fig. 5. 34 repeats of DYS449

TEST RESULTS

The value in testing is found in comparative analyses. Human DNA varies by less than 0.1 percent. That is still a lot of data. Some testing looks at ten million positions.


Y-STR Results


89175132415101113121210131130
110624132415111113121210131130
238610132415111113121210131130
391325132415111113121210131130
160752132415111113121210131130
212010132415111113121210131130
128096132415111113121210131130
284548132415111113121210131130
520597132415111113121210131130
98452132415111113121210131130
N70352132415111113121210131130
N3690132415111113121210131130
102135132415111113121210131130
305732132415111113121210131130
57597132415111113121210131130
239164132415111113121213131130
323704132515111113121210131130
Fig. 6. Comparing Repeats (STRs)

The most popular male-only test looks at the repeats on the Y chromosome, as in the example for my DYS449 repeats. These are called Short Tandem Repeats, or STRs. Generally, comparing surnames and 37 repeat regions — DYS449 just being one—can show a tester which group of Smiths, or Johnsons, or Cooleys, he belongs to. For example, this is what my group of Cooleys looks like by comparing only the first twelve regions. Remember, these numbers represent the number of repeats of certain letters (a different sequence for each location). Each highlighted value represents a mismatch between testers. There should be no more than one mismatch in a group. Otherwise, the mismatched tester probably doesn't belong in the group.

More than twelve markers are required to make sensible determinations. Most project administrators will recommend that 37 markers be tested. With matches on both surname and markers, you have a specific surname group.


Y-SNP Results


Repeats tend to mutate regularly. They're fine for determining who belongs in a surname group, but single point mutations are needed to make finer judgements. These are called Single Nucleotide Polymorphisms, or SNPs. Once these mutations occur, they tend to stick around for hundreds of generations, even hundreds of thousands of years, passed from one generation to the next. Advanced SNP testing, for example, has shown that one of the Cooley groups should be broken into three or more groups. Descendants of early colonial immigrant, Benjamin Cooley, have a SNP mutation named A12022. With the birth of a man born around the year 1600, position 15070226 of the Y chromosome flipped from an A to a G. Those Cooleys not having it are not descended from Ben, despite what they may believe.


Mitochondrial Results


SNP mutations are also used in testing mitochondrial DNA, that DNA inherited from the mother. MT-DNA has fewer than 17,000 bases, as opposed to about 37 million for the Y chromosome. Mutations are more rare. Test results are arranged into clans. I'm of clan H, nicknamed Helen, as was my mother by virtue of the fact that those mutations came from her. My dad was of clan V, nicknamed Velda, which is a rare European type. His mother was also of clan V.


Autosomal Results


SNP mutations are discovered by comparing test results to a model, those bases that are presently believed to have been the ancestral values, the values present before the occurrence of mutations. We're now working with a model called hg38—the 38th version of the human genome. Although SNPs are analyzed in chromosomes 1 through 22, rather than initially comparing to the model genome, the results are based on the number of differences between two people. It should be noted that autosomal DNA testing, is the only test offered by AncestryDNA.

 Segmts
father3586.9
sister2695.8
half-sister1897.1
second cousin235.8
third cousin98.5
Fig. 7. Autosomes

Once again, using myself as an example, I share DNA 3586.9 segments of DNA with my dad, about half, 2695.8 segments with my sister, and 1897.1 segments with my half-sister. The segment count falls in line with our relationships.

Because autosomes go through recombination with each generation, the number of potential matches significantly declines. Shared segments become so tiny that after five or six generations it's uncertain that two people match because of common descent or simply by chance due to mutation. And a tester isn't going to match to two siblings in the same because we each have differing combination of our parents' DNA. That's especially true between you and any two cousins. Several third cousins descended from the same great-great-grandparents will not share the same matches, although some overlap may exist.

The Y chromosome and mitochondrial DNA are inherited in a specific pattern—father to son and mother to child. Two people that match know exactly why they match. They may not know the name of common ancestor, but they know that the DNA lineage itself matches. For example, I share a huge portion of my Y-DNA with a man named Hackett. We can't identify the ancestor, but we know he was a man living about 800 years ago, likely in Scotland, and that we each descend from different sons.

This isn't true with automomal matching. There is no pattern because we inherit chromosomes 1 through 22 from all our ancestors. The only way to sort it out is to determine the degree of relationship with a matching test, contact the individual, then compare notes.

But autosomes do more than determine relationships, if not lineages. They can provide an ethnic breakdown. It was no surprise to me to discover that I'm 99.9 percent Western European, but there's more to it. Here's a small sampling of my breakdown:


North Atlantic Baltic West
Medit.
Other
Fig. 8. Admixture

SUMMARY

Test Ancestors "tested for" Benefits
Y Chromosome
Short Tandem Repeats
(STRs)
"The Father Line"
(father's, father's, father, etc.)
Good for matching your Father Line with other testers with accuracy to about fifteen generations. Perfect for homing in on the American origins of your surname and placing your results in the proper group in a surname project.
Y Chromosome
Single Nucleotide
Polymorphisms (SNPs)
"The Father Line"
(father's, father's, father, etc.)
Deep Ancestry: Provides genetic information about the Father Line to thousands, even hundreds of thousands, of years. These mutations are highly stable.
Mitochondrial DNA "The Mother Line"
(mother's, mother's, mother, etc.)
Deep Ancestry: Provides genetic information about he Mother Line to thousands, even hundreds of thousands, of years.
Autosomal DNA A large sampling of many ancestors that are still represented in your DNA. (About 3% of your total genome is tested.) Helps in two ways:
1. Close genealogy to about five generations
2. Deep Ancestry: Broad sampling and general interpretation of ethnic origins.

TESTING COMPANIES


Test 23andMe FTDNA Ancestry.com
aDNA $199 $79 $99
aDNA Transfer No $69 No
X Included Included No
Y-STR No 12 markers: $59
37 markers: $169
67 markers: $268
111 markers: $359
No
Big Y No Ten million SNPS
$575
No
Y-SNP Included minimally Several products,
including Big Y, or $39/SNP
No
mtDNA Included minimally Included or $69 No
Full mtDNA No $199 No
Medical markers Yes No No
Matching Yes Yes Limited for non-member customers
Database Matches only Public Private

And autosomal test results can be transferred to gedmatch.com at no charge for further analysis.